Tuesday, October 14, 2014

Paper machine :: Claudia González Godoy 

Nicely done. 

Thursday, September 25, 2014

p-dpa:

Unlimited Vocabulary, Jane Birkin (2013)

The piece explores the dysfunction of the limited vocabulary, as provided by various metadata schema and used commonly for the description of images in museums, libraries and archives. Schemas are blunt tools of description, hampered by a Spartan narrowness of vocabulary; and as finding aids they become no less problematic. Unlimited Vocabulary is a model of dysfunction in itself, albeit a different dysfunction to that of the metadata schema. The vocabulary is an unwieldy 300 metres long — the rolls are shown partly unfurled to demonstrate the scope of the vocabulary, but most of the words remain unseen. As Cornelia Vismann observes of Alselm Kiefer’s lead books, they are ‘files at a standstill […] nothing more than alphabetic media.’ (Cornelia Vismann, Files: Law and Media Technology (Stanford: California, Stanford University Press, 2008) 162)

This is by no means a truly unlimited vocabulary, as we are told that the English language has recently hit one million words — although there is no way of corroborating this information, and the million words are certainly not accessible as a list. This is a vocabulary of more than 20,000 words, taken and adapted from lists of words for scrabble players and other word gamers, and then randomised.

Inspiration is drawn in part from the 1955 RAND Corporation publication One Million Random Numbers, a work succinctly described by an unnamed blogger as ‘a monstrous anti-table, a work of intentional disorder.’ Unlimited Vocabulary is both of these things.

Wednesday, September 24, 2014
Tiempo habitado :: Gabriela Gordillo 
Mural 2.50 x 2.40 mts. / Mérida, Yucatán 2014
[graphic intervention following a generative principle]

Tiempo habitado :: Gabriela Gordillo 

Mural 2.50 x 2.40 mts. / Mérida, Yucatán 2014

[graphic intervention following a generative principle]

I share with you my last project Inhabited Time, a participative mural realiced at Merida Yucatán, at the Anthropology Museum Palacio Cantón.

"Tiempo habitado" is a generative process activated through participation.
The mural is determined by a constantly moving grid that suggests a graphic structure. The result is an emerging pattern derived from the intersection between time movement (projection) and human intervention through drawing. 

The piece was open to public during 3 days, (21 hours), and intervened by proximately 200 visitors.

You can see the full project here:
http://gabrielagordillo.net/Inhabited-Time

Untitled (I Lovjad), c.1971poliptyque, 3 dessins, pointe feutre et crayon sur papier, pliure au centre, timbre sec de la Succession. 

Untitled (I Lovjad), c.1971
poliptyque, 3 dessins, pointe feutre et crayon sur papier, pliure au centre, timbre sec de la Succession. 

Monday, September 22, 2014

the human genome. chromosome one (excerpt):
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC
ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC
ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG
TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA
CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA
CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA
CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCA

more info here:
http://joerg.piringer.net/codepoetry

Friday, August 22, 2014 Monday, July 21, 2014
“Art or Sound” exhibition // The boundary between the visual arts and sound production. 
artcatalogue:

Art or Sound
Edited by Germano Celant 
Published by Progetto Prada Arte, Milan 2014
Preface by Miuccia Prada and Patrizio Bertelli
Introductory essay by Germano Celant
Critical essays by Jo Applin, Luciano Chessa, Christopoh Cox, Geeta Dayal, Patrick Feaster, Christoph E. Hänggi, Bart Hopkin, Douglas Kahn, Alan Licht, Andrea Lissoni, Noel Lobley, Deirdre Loughridge, Simone Menegoi, Holly Rogers, Jonathan Sterne, David Toop, John Tresch, Eric de Visscher and Rob Young. 
English edition includes Italian translations.
Download

“Art or Sound” exhibition // The boundary between the visual arts and sound production. 

artcatalogue:

Art or Sound

Edited by Germano Celant 

Published by Progetto Prada Arte, Milan 2014

Preface by Miuccia Prada and Patrizio Bertelli

Introductory essay by Germano Celant

Critical essays by Jo Applin, Luciano Chessa, Christopoh Cox, Geeta Dayal, Patrick Feaster, Christoph E. Hänggi, Bart Hopkin, Douglas Kahn, Alan Licht, Andrea Lissoni, Noel Lobley, Deirdre Loughridge, Simone Menegoi, Holly Rogers, Jonathan Sterne, David Toop, John Tresch, Eric de Visscher and Rob Young. 

English edition includes Italian translations.

Download

Monday, May 5, 2014

Notation out of a dialogue // 

Quema de ropa en San Juan Tabaa ::  

Interpreted by Fernando Vigueras 

A notation exercise that uses the scheme of tequio, an organized way of working that happens in different Mexican native groups. Through graphics, it reflects the dialogue structure from discussions on specific topics. This project was developed by Daniel Godínez Nivón with the AMICD (Asamblea de Migrantes Indígenas de la Ciudad de México). 

tequiorolas:


No. 13. La palabra.
La asamblea existe por la palabra. La organización municipal social y administrativa es parte de una estructura colectiva. Se reconoce como máxima autoridad a la Asamblea General del Pueblo, seguida del Ayuntamiento Municipal, que se integra por un Presidente, un Síndico, Regidores de Hacienda, de Obras, de Educación y de Salud; además de un Secretario y un Tesorero. 
Es obligación de todos los ciudadanos acudir puntualmente en la fecha y hora convocadas por la autoridad municipal para la celebración de asambleas, y permanecer en ellas todo el tiempo hasta que se declare concluida, salvo por causa justificada. El incumplimiento de lo anterior, dará lugar a la imposición de una multa por la cantidad que acuerde la Asamblea General.

A notation exercise that uses the scheme of tequio, an organized way of working that happens in different Mexican native groups. Through graphics, it reflects the dialogue structure from discussions on specific topics. This project was developed by Daniel Godínez Nivón with the AMICD (Asamblea de Migrantes Indígenas de la Ciudad de México). 

tequiorolas:

No. 13. La palabra.

La asamblea existe por la palabra. La organización municipal social y administrativa es parte de una estructura colectiva. Se reconoce como máxima autoridad a la Asamblea General del Pueblo, seguida del Ayuntamiento Municipal, que se integra por un Presidente, un Síndico, Regidores de Hacienda, de Obras, de Educación y de Salud; además de un Secretario y un Tesorero. 

Es obligación de todos los ciudadanos acudir puntualmente en la fecha y hora convocadas por la autoridad municipal para la celebración de asambleas, y permanecer en ellas todo el tiempo hasta que se declare concluida, salvo por causa justificada. El incumplimiento de lo anterior, dará lugar a la imposición de una multa por la cantidad que acuerde la Asamblea General.

Thursday, May 1, 2014

OptoSono :: Arcángel Constantini

A sound instrument based on the principle of the optical sound of cinematography, the work of Norman McLaren, and Graham Bell.

Opto Sono is an  analogous sequencer system that uses a pair of photocells and custom build preamplifiers that transform the luminance phenomena into electricity and this in sound, the transformed and amplified energy find unusual ways when making short circuits by means of corporal resistance.


Phonotube :: Arcángel Constantini
Experimental instruments for live audio visual performance based on the photophone, patented by Graham Bell. 
project- http://www.arc-data.net/phonotube/

phonotube

Phonotube :: Arcángel Constantini

Experimental instruments for live audio visual performance based on the photophone, patented by Graham Bell. 

project- http://www.arc-data.net/phonotube/

Wednesday, April 23, 2014

Threnoscope / in process

via animatednotation.com

20 code experiments on the relationship between sound and graphics

Hackpact :: Realität (2010-2011)

Wednesday, April 2, 2014

unicode :: by Jörg Piringer

all displayable characters in the unicode range 0 - 65536 (49571 characters). one character per frame.

joerg.piringer.net/unicode/